Tslrn1
Species: Mus musculus
Position: chrX: 62510538-62527011
Known as: Tslrn1 , ENSMUSG00000085757
Transcript: NR_045442 , NR_045443 , ENSMUST00000129479 , ENSMUST00000133350
Sequence: Download
Description:
Tslrn1 (testis-specific long noncoding RNA 1) is an X-linked lncRNA, with a dynamic expression pattern during murine spermatogenesis. The male mice carrying a Tslrn1 deletion displayed normal fertility but a significant reduction in spermatozoa. These findings demonstrate that dysregulation of specific mammalian lncRNAs is a novel mechanism of low sperm count or infertility, thus potentially providing new biomarkers and therapeutic strategies.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | TATATTTCTTGGTGGCACAC | 62527669-62527688(+) | up stream | 20 | AGG | CRISPRko | Experimental validated | embryo | paried with sgRNA2 | [1] |
| sgRNA2 | TGACACTGTATCCTTTCATC | 62509990-62510009(+) | down stream | 20 | TGG | CRISPRko | Experimental validated | embryo | paried with sgRNA1 | [1] |
GBrowser
Links
Reference
1. Wichman L, Somasundaram S, Breindel C, Valerio DM, McCarrey JR, et al. (2017). Dynamic expression of long noncoding RNAs reveals their potential roles in spermatogenesis and fertility. Biol Reprod 97(2): 313-323.







