RP6-24A23.3

Species: Homo sapiens

Position: chrX: 108736010-108737459

Known as:

Transcript: ENST00000608811

Sequence: Download

Description:

We developed a CRISPR interference (CRISPRi) platform targeting 16,401 lncRNA loci in seven diverse cell lines, including six transformed cell lines and human induced pluripotent stem cells (iPSCs). We classified lncRNA genes as hits if their combined phenotype effect size and P value (referred to here as “screen score”) exceeded a consistent threshold applied to each screen corresponding to an empirical FDR of 5%. Large-scale screening identified 499 lncRNA loci required for robust cellular growth, of which 89% showed growth modifying function exclusively in one cell type.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 GTAGTATTCCAGCCGAGCTG 108736009-108736028(+) gene body (near 5') 20 GGG CRISPRi Partial validated HEK293T NA [1]
sgRNA2 GGGCTGGGGCGGGCAGACGA 108736427-108736446(-) gene body (near 5') 20 GGG CRISPRi Partial validated HEK293T NA [1]
sgRNA3 TCCCGAGGAAAGAAGCGGGG 108736231-108736250(+) gene body (near 5') 20 TGG CRISPRi Partial validated HEK293T NA [1]
sgRNA4 AGAGGAGGACCTGCCCGTCG 108736119-108736138(-) gene body (near 5') 20 GGG CRISPRi Partial validated HEK293T NA [1]
sgRNA5 ACTAAGAGGTGCAGCAGCGG 108736284-108736303(-) gene body (near 5') 20 CGG CRISPRi Partial validated HEK293T NA [1]
sgRNA6 GGGGTTCCCGAGGAAAGAAG 108736226-108736245(+) gene body (near 5') 20 CGG CRISPRi Partial validated HEK293T NA [1]
sgRNA7 CGACCCGGTCCCAATGAGTG 108736201-108736220(+) gene body (near 5') 20 CGG CRISPRi Partial validated HEK293T NA [1]
sgRNA8 AGACTGCTGACGCCCCAGCT 108736024-108736043(-) gene body (near 5') 20 CGG CRISPRi Partial validated HEK293T NA [1]
sgRNA9 TCTGCAAACGCGGCTACCTG 108736090-108736109(-) gene body (near 5') 20 CGG CRISPRi Partial validated HEK293T NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Liu SJ, Horlbeck MA, Cho SW, Birk HS, Malatesta M, et al. (2017). CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science 355(6320).