PCAT19
Species: Homo sapiens
Position: chr19: 41454168-41500649
Known as: PCAT19 , ENSG00000267107
Transcript: NR_136334 , NR_040109 , ENST00000588495 , ENST00000594315
Sequence: Download
Description:
The prostate cancer (PCa) risk-associated SNP rs11672691 is positively associated with aggressive disease at diagnosis. We showed that rs11672691 maps to the promoter of a short isoform of long noncoding RNA PCAT19 (PCAT19-short), which is in the third intron of the long isoform (PCAT19-long). The risk variant is associated with decreased and increased levels of PCAT19-short and PCAT19-long, respectively. Mechanistically, the risk SNP region is bifunctional with both promoter and enhancer activity. The risk variants of rs11672691 and its LD SNP rs887391 decrease binding of transcription factors NKX3.1 and YY1 to the promoter of PCAT19-short, resulting in weaker promoter but stronger enhancer activity that subsequently activates PCAT19-long. PCAT19-long interacts with HNRNPAB to activate a subset of cell-cycle genes associated with PCa progression, thereby promoting PCa tumor growth and metastasis. Taken together, these findings reveal a risk SNP-mediated promoter-enhancer switching mechanism underlying both initiation and progression of aggressive PCa.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GTAACGAGACCCTTAATCGC | 41479518-41479537(-) | gene body (near 5') | 20 | TGG | CRISPRi;CRISPRa | Experimental validated | V16A;LNCaP | NA | [1] |
| sgRNA2 | TTTCTCCACTAGCATTTCCA | 41479610-41479629(+) | gene body (near 5') | 20 | TGG | CRISPRi;CRISPRa | Experimental validated | V16A;LNCaP | NA | [1] |
| sgRNA3 | ACTGAGTGAAAAGAAAAGCC | 41501312-41501331(+) | up stream | 20 | CGG | CRISPRi;CRISPRa | Experimental validated | V16A;LNCaP | NA | [1] |
| sgRNA4 | TGAGTGAAAAGAAAAGCCCG | 41501314-41501333(+) | up stream | 20 | GGG | CRISPRi;CRISPRa | Experimental validated | V16A;LNCaP | NA | [1] |
| sgRNA5 | GGTAAAATGCCTCCACTCTCC | 41501236-41501255(-) | up stream | 21 | AGG | CRISPRa | Experimental validated | LNCaP | NA | [1] |
| sgRNA6 | GGGAAGGCAGCTGCTTCTAAT | 41501292-41501311(-) | up stream | 21 | TGG | CRISPRa | Experimental validated | LNCaP | NA | [1] |
| sgRNA7 | CTGAGTGAAAAGAAAAGCCCG | 41501313-41501333(+) | up stream | 21 | GGG | CRISPRa | Experimental validated | LNCaP | NA | [1] |
GBrowser
Links
Reference
1. Hua JT, Ahmed M, Guo H, Zhang Y, Chen S, et al. (2018). Risk SNP-Mediated Promoter-Enhancer Switching Drives Prostate Cancer through lncRNA PCAT19. Cell 174(3): 564-575.e18.







