PANDAR
Species: Homo sapiens
Position: chr6: 36673620-36675126
Known as: PANDAR , ENSG00000281450
Transcript: NR_109836 , ENST00000629595
Sequence: Download
Description:
PANDAR are upregulated in Gastric cancer (GC) patients, positively correlated with increased tumor size and advanced TNM classification and a poor survival rate. PANDAR regulates CDKN1A gene transcription in a p53-dependent manner. By combination of PANDAR depletion and nutlin-3 (a p53 activator), the cell-cycle progression at the G1/S checkpoint was blocked and the apoptotic activity was increased, suggesting PANDAR is a powerful diagnostic and therapeutic marker for patients with GC.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | CGTGCACACATTTAACCCGA | 36674842-36674861(+) | gene body (near 5') | 20 | AGG | CRISPRko | Experimental validated | AGS | NA | [1] |
GBrowser
Links
Reference
1. Liu J, Ben Q, Lu E, He X, Yang X, et al. (2018). Long noncoding RNA PANDAR blocks CDKN1A gene transcription by competitive interaction with p53 protein in gastric cancer. Cell Death Dis 9(2): 168.







