MANTIS
Species: Homo sapiens
Position: chr2: 69789551-69798948
Known as:
Transcript: KY859180
Sequence: Download
Description:
A search for epigenetically controlled endothelial lncRNAs yielded lncRNA n342419, here termed MANTIS, as the most strongly regulated lncRNA. Controlled by the histone demethylase JARID1B, MANTIS was downregulated in patients with idiopathic pulmonary arterial hypertension and in rats treated with monocrotaline, whereas it was upregulated in carotid arteries of Macaca fascicularis subjected to atherosclerosis regression diet, and in endothelial cells isolated from human glioblastoma patients. MANTIS lncRNA plays a significant and unique role for endothelial cell function by acting as a scaffolding lncRNA within a chromatin-remodeling complex, mediating and directing efficient key endothelial gene transcription.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | CTTCATTTTGAGGGCTCGTC | 69798817-69798836(-) | gene body (near 5') | 20 | TGG | CRISPRko | Experimental validated | HUVEC | NA | [1] |
| sgRNA2 | CTACCACTTGGCAACCCGCT | 69789612-69789631(-) | gene body (near 3') | 20 | CGG | CRISPRko | Experimental validated | HUVEC | NA | [1] |
GBrowser
Links
Reference
1. Leisegang MS, Fork C, Josipovic I, Richter FM, Preussner J, et al. (2017). Long Noncoding RNA MANTIS Facilitates Endothelial Angiogenic Function. Circulation 136(1): 65-79.







