CTD-3193K9.3

Species: Homo sapiens

Position: chr17: 42683186-42699466

Known as:

Transcript: ENST00000592440

Sequence: Download

Description:

We developed a CRISPR interference (CRISPRi) platform targeting 16,401 lncRNA loci in seven diverse cell lines, including six transformed cell lines and human induced pluripotent stem cells (iPSCs). We classified lncRNA genes as hits if their combined phenotype effect size and P value (referred to here as “screen score”) exceeded a consistent threshold applied to each screen corresponding to an empirical FDR of 5%. Large-scale screening identified 499 lncRNA loci required for robust cellular growth, of which 89% showed growth modifying function exclusively in one cell type.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 CCCCCCCCATCAAGTTTGGT 42699037-42699056(+) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA2 AACAGGGATGAGAAGGGCAT 42699112-42699131(-) gene body (near 5') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA3 AGGGCTGCAGAGGGTATGGG 42699307-42699326(+) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA4 GCCCCAAAGGAGAAGCCTCA 42699157-42699176(+) gene body (near 5') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA5 GCTGATAGTGTCTATTGGAA 42699265-42699284(-) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA6 GTGAGGCTCGGCCACTCCCT 42699081-42699100(-) gene body (near 5') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA7 GATAGTGTCTATTGGAAGGG 42699262-42699281(-) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA8 GGACCTATGTCAACCCCATG 42699175-42699194(-) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA9 GGGATTAACAACAGAGTGTA 42699225-42699244(+) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA10 TCTGTGTACAAAACAAAAGG 42699441-42699460(-) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Liu SJ, Horlbeck MA, Cho SW, Birk HS, Malatesta M, et al. (2017). CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science 355(6320).