CTD-2651B20.6

Species: Homo sapiens

Position: chr15: 45200324-45200632

Known as:

Transcript: ENST00000563103

Sequence: Download

Description:

We developed a CRISPR interference (CRISPRi) platform targeting 16,401 lncRNA loci in seven diverse cell lines, including six transformed cell lines and human induced pluripotent stem cells (iPSCs). We classified lncRNA genes as hits if their combined phenotype effect size and P value (referred to here as “screen score”) exceeded a consistent threshold applied to each screen corresponding to an empirical FDR of 5%. Large-scale screening identified 499 lncRNA loci required for robust cellular growth, of which 89% showed growth modifying function exclusively in one cell type.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 GTCGCTCTCAAATGTCACAA 45200294-45200313(+) down stream 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA2 ATCCGAGTCACGGCATTGTG 45200408-45200427(-) gene body (near 3') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA3 CGGCGAGCTACTAGGGACAC 45200481-45200500(+) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA4 AGGATCAAGGTAGCTCTTAA 45200074-45200093(-) down stream 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA5 GCTCTGGCTAAATTGGACTT 45200264-45200283(-) down stream 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA6 ACGATCACGGCGAGCTACTA 45200474-45200493(+) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA7 GGGAGCGGATTCCTAATGAT 45200122-45200141(-) down stream 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA8 TTCGTGTACAGAGGCTTGAA 45200018-45200037(-) down stream 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA9 TACGCTGGCTCTGGCTAAAT 45200271-45200290(-) down stream 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA10 TCACGGCATTGTGAGGACAA 45200401-45200420(-) gene body (near 3') 20 TGG CRISPRi Partial validated iPSC NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Liu SJ, Horlbeck MA, Cho SW, Birk HS, Malatesta M, et al. (2017). CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science 355(6320).