CCAT2
Species: Homo sapiens
Position: chr8: 127400398-127402150
Known as: CCAT2 , ENSG00000280997
Transcript: NR_109834 , ENST00000630920
Sequence: Download
Description:
CCAT2 (Colon cancer-associated transcript-2) lncRNA, has been reported to be over-expressed in colorectal cancer (CRC) and is found to promote tumor growth. CCAT2 is enriched in the nucleus and can act as a negative regulator of miRNA-145 biogenesis via blocking cleavage of pre-miR-145 by Dicer in vitro. Modulated expression of CCAT2 regulates the expression of miR-145 in colon cancer HCT-116 and HT-29 cells. Knockout of CCAT2 increases miR-145 and negatively regulates miR-21 in HCT-116 cells, impairs proliferation and differentiation. In contrast, stable up-regulation of CCAT2 decreases mature miR-145 and increases the expression of several CSC markers in colon cancer cells.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GAGCTAAGAGGAAACCACCT | 127400608-127400627(+) | gene body (near 5') | 20 | TGG | CRISPRko | Experimental validated | HCT116 | paried with sgRNA2 | [1] |
| sgRNA2 | CTCCTATTCATACCATATTA | 127401686-127401705(-) | gene body (near 3') | 20 | AGG | CRISPRko | Experimental validated | HCT116 | paried with sgRNA1 | [1] |
GBrowser
Links
Reference
1. Yu Y, Nangia-Makker P, Farhana L, Majumdar APN (2017). A novel mechanism of lncRNA and miRNA interaction: CCAT2 regulates miR-145 expression by suppressing its maturation process in colon cancer cells. Mol Cancer 16(1): 155.







