AK170409
Species: Mus musculus
Position: chrX: 19156980-19167232
Known as: ENSMUSG00000073274
Transcript: ENSMUST00000143129
Sequence: Download
Description:
lincRNA-AK170409 shows high induction with LPS and Pam3CSK4 in both primary macrophages and in our iBMDMs reporter cells, and possesses an inducible ChIP peak for transcription factor c-Jun, a component of the AP-1 transcription complex with roles in inflammation. It was localized strictly to the nucleus. Knocking out this lincRNA could be lethal to cells, whereas deletion of one allele of the AK70409 locus could resulted in 50% reduction in this lincRNA expression, as evaluated by qPCR. When lincRNA-AK170409 was knocked down, genes with known roles in the TLR-signaling pathway are altered, one of the most down-regulated genes was the aryl hydrocarbon receptor (Ahr) gene, which encodes a ligand-activated transcription factor known to regulate immune responses.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GAAAAATTGGGTGTCTGGTT | 19168204-19168223(-) | up stream | 20 | TGG | CRISPRko | Experimental validated | iBMDM | NA | [1] |
| sgRNA2 | TTGACTTTAGATGTCGGTAA | 19168158-19168177(-) | up stream | 20 | AGG | CRISPRko | Experimental validated | iBMDM | NA | [1] |
| sgRNA3 | AGAGTATCTTCTCATAAGTA | 19156453-19156472(+) | down stream | 20 | AGG | CRISPRko | Experimental validated | iBMDM | NA | [1] |
| sgRNA4 | GCAGGAGTGATTGTATGAAG | 19156387-19156406(-) | down stream | 20 | TGG | CRISPRko | Experimental validated | iBMDM | NA | [1] |
GBrowser
Links
Reference
1. Covarrubias S, Robinson EK, Shapleigh B, Vollmers A, Katzman S, et al. (2017). CRISPR/Cas-based screening of long non-coding RNAs (lncRNAs) in macrophages with an NF-κB reporter. J Biol Chem 292(51): 20911-20920.







