AC022154.7

Species: Homo sapiens

Position: chr19: 48620503-48624132

Known as:

Transcript: ENST00000594850

Sequence: Download

Description:

We developed a CRISPR interference (CRISPRi) platform targeting 16,401 lncRNA loci in seven diverse cell lines, including six transformed cell lines and human induced pluripotent stem cells (iPSCs). We classified lncRNA genes as hits if their combined phenotype effect size and P value (referred to here as “screen score”) exceeded a consistent threshold applied to each screen corresponding to an empirical FDR of 5%. Large-scale screening identified 499 lncRNA loci required for robust cellular growth, of which 89% showed growth modifying function exclusively in one cell type.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 TTCTGGAATGGAAGCCGCGA 48623740-48623759(-) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA2 AGGCAGAGACCCACAGAGGT 48623967-48623986(-) gene body (near 5') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA3 ATCTCAGGCTCAAACCAGAA 48623691-48623710(-) gene body (near 5') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA4 TAAACAAGAGACCAAAACAG 48623838-48623857(-) gene body (near 5') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA5 GAAAAGGGGCGTGAGGGAGG 48624061-48624080(-) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA6 TGTGTCTGGATCGGATCTCT 48623992-48624011(+) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA7 TTGCCTCATCCAACCTCTGT 48623955-48623974(+) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA8 GACTCTAACACGCGTAACAA 48624018-48624037(-) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA9 GATGAGGCAATAAGAGAGCT 48623945-48623964(-) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA10 GCCTTGCTCTGTGTCTGGAT 48623983-48624002(+) gene body (near 5') 20 CGG CRISPRi Partial validated iPSC NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Liu SJ, Horlbeck MA, Cho SW, Birk HS, Malatesta M, et al. (2017). CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science 355(6320).